| Primary Identifier | MGI:6258608 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Polr2l |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGAGTCTGTAGGCCTTGCTA and CTATCCACACGAATACCCAG, which resulted in a 1828 bp deletion beginning at Chromosome 7 position 141,471,653 bp and ending after 141,473,480 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000668186 (exon 2) and 283 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 32 and immediate truncation probably due to run on into the intron. |
