|  Help  |  About  |  Contact Us

Allele : Wdr70<em1(IMPC)J> WD repeat domain 70; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6259591 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Wdr70
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTGGGGATCTTGTGATACA and CATCTGGAATGGAATCCCCC, which resulted in a 453 bp deletion beginning at Chromosome 15 position 8,082,304 bp and ending after 8,082,756 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000564027 (exon 4) and 332 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 58 and early truncation 20 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories