| Primary Identifier | MGI:6258620 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Slain2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTATAGGACTATAAAGTAG and TTGAGTGTGTATATTTAGGC, which resulted in a 287 bp deletion beginning at Chromosome 5 position 72,941,237 bp and ending after 72,941,523 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001058225 (exon 2) and 138 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 129 and early truncation 9 amino acids later. |
