| Primary Identifier | MGI:6259110 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cr2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated by Dr. Luanne Peters at The Jackson Laboratory by microinjection of Cas9 mRNA and 4 guide sequences, GTTGACCAGTTTGTTGCG, GTACTTCTCCTGTAATGAA, GCACACATGGGATCCTT, and GTTCTTGGTGAGCTGGGCAC, which resulted in a 60 bp deletion beginning at approximately Chromosome 1 position 195176543 bp, CTTGGG, and ending after 195176602 bp, GCTGGG (GRCm38.p4/mm10). This mutation deletes most of exon 1 and some of the downstream intron. |
