|  Help  |  About  |  Contact Us

Allele : Cr2<em1Llp> complement receptor 2; endonuclease-mediated mutation 1, Luanne Peters

Primary Identifier  MGI:6259110 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cr2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated by Dr. Luanne Peters at The Jackson Laboratory by microinjection of Cas9 mRNA and 4 guide sequences, GTTGACCAGTTTGTTGCG, GTACTTCTCCTGTAATGAA, GCACACATGGGATCCTT, and GTTCTTGGTGAGCTGGGCAC, which resulted in a 60 bp deletion beginning at approximately Chromosome 1 position 195176543 bp, CTTGGG, and ending after 195176602 bp, GCTGGG (GRCm38.p4/mm10). This mutation deletes most of exon 1 and some of the downstream intron.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele