| Primary Identifier | MGI:6259158 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Haus4 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGGGCACATGAGCAGGCCG and GCACACAGACTGTTAGCACG, which resulted in a 137 bp deletion beginning at Chromosome 14 position 54,545,708 bp and ending after 54,545,844 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000124158 (exon 6) and 40 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 155 and early truncation 6 amino acids later. |
