| Primary Identifier | MGI:6259165 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fam222a |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAGGTTTTGGTCCAGAAGT and TTGCCCCTATGGATGGACCA, which resulted in a 2716 bp deletion beginning at Chromosome 5 position 114,610,703 bp and ending after 114,613,418 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000389063 (exon 3) and 322 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after 29 amino acids. |
