| Primary Identifier | MGI:6276283 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cox16 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, GTAACACGCGCGTTCACGAA and GCTAATGCACAAGTAGCACC, which resulted in a 645 bp deletion beginning at Chromosome 12 position 81,484,671 bp and ending after 81,485,315 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000912604 (exon 1) and 421 bp of flanking intronic sequence including the translation start site and is predicted to generate a null allele. |
