| Primary Identifier | MGI:6276947 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Taf12 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from IMPC was generated at UC Davies by injecting CAS9 Protein and 2 guide sequences CCTTCAGCGCTAATCAACCTCTC, CCGTGGGGAAGATAGCAGGCACT, which resulted in an Intra-exdel deletion. A 90bp deletion of bases 23 to 113 of the protein coding sequence was verified by RNA sequencing. This alteration is predicted to cause early truncation after 7 amino acids. Although mutant mRNA is produced, a mutant protein likely retains no TAF12 functions based on early missense amino acids and early termination. |
