|  Help  |  About  |  Contact Us

Allele : Ccdc172<em1(IMPC)J> coiled-coil domain containing 172; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6274357 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ccdc172
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAAACAAGCTGTCCAGACGT and TTCCAGGTCAGCGTGTGTAA, which resulted in a 2258 bp deletion beginning at Chromosome 19 position 58,525,572 bp and ending after 58,527,829 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000147905 and ENSMUSE00000147900 (exons 4,5) and 1975 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 55 and early truncation 1 amino acid later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories