| Primary Identifier | MGI:6274357 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ccdc172 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAAACAAGCTGTCCAGACGT and TTCCAGGTCAGCGTGTGTAA, which resulted in a 2258 bp deletion beginning at Chromosome 19 position 58,525,572 bp and ending after 58,527,829 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000147905 and ENSMUSE00000147900 (exons 4,5) and 1975 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 55 and early truncation 1 amino acid later. |