| Primary Identifier | MGI:6259828 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Ezh2 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/Cas9 technology using guide RNA (CCCCAGCCTGCCACATCAGACGG), SpCas9, and a 127 bp ssODN template introduce a c.1876 G-to-A transversion (NM_004456.4). The resultant GTG to ATG bp (p.V626M) substitution in exon 16 of the gene is confirmed through sequencing. |