|  Help  |  About  |  Contact Us

Allele : Tex36<em1(IMPC)J> testis expressed 36; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6259893 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tex36
Inheritance Mode  Not Specified Strain of Origin  Not Specified
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTCTTTTCACCTGTCAAGA and GGACAATGCTGAATCCATGA, which resulted in a 571 bp deletion beginning at Chromosome 7 position 133,601,825 bp and ending after 133,602,395 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000205104 (exon 1) and 380 bp of flanking intronic sequence including the translation start site and splice donor and is predicted to cause a null allele.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories