| Primary Identifier | MGI:6259893 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tex36 |
| Inheritance Mode | Not Specified | Strain of Origin | Not Specified |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTCTTTTCACCTGTCAAGA and GGACAATGCTGAATCCATGA, which resulted in a 571 bp deletion beginning at Chromosome 7 position 133,601,825 bp and ending after 133,602,395 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000205104 (exon 1) and 380 bp of flanking intronic sequence including the translation start site and splice donor and is predicted to cause a null allele. |
