| Primary Identifier | MGI:6259989 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Wdr18 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGTCCTTCCACTACTTGGG and GACACAGTATGCCTTCAGAC, which resulted in a 2235 bp deletion beginning at Chromosome 10 position 79,964,652 bp and ending after 79,966,886 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000314370-ENSMUSE00000314328 (exons 3-8) and 1458 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 108 removing 258 amino acids and to retain the last 65 amino acids before the stop. |
