| Primary Identifier | MGI:6274400 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ankrd24 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGGCACACCCAGAGGTGCGA and ATGGAAGGACCGTCCCTGGG, which resulted in a 339 bp deletion beginning at Chromosome 10 position 81,634,842 bp and ending after 81,635,180 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001232215 and ENSMUSE00001292617 (exons 3 and 4) and 119 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 12 and early truncation 16 amino acids later. |
