| Primary Identifier | MGI:6260179 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tspyl4 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATTGCCAGTTCTCGCGCTA and GTCTGGGTGAATGTACAGTT, which resulted in a 3982 bp deletion beginning at Chromosome 10 position 34,297,362 bp and ending after 34,301,343 bp (GRCm38/mm10) with a single base pair insertion (C) at the deletion site. This mutation deletes ENSMUSE00000316800 (exon 1) and 103 bp of flanking intronic sequence including the entire coding sequence and is predicted to generate a null allele. |
