|  Help  |  About  |  Contact Us

Allele : Tspyl4<em1(IMPC)J> TSPY-like 4; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6260179 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tspyl4
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATTGCCAGTTCTCGCGCTA and GTCTGGGTGAATGTACAGTT, which resulted in a 3982 bp deletion beginning at Chromosome 10 position 34,297,362 bp and ending after 34,301,343 bp (GRCm38/mm10) with a single base pair insertion (C) at the deletion site. This mutation deletes ENSMUSE00000316800 (exon 1) and 103 bp of flanking intronic sequence including the entire coding sequence and is predicted to generate a null allele.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele