| Primary Identifier | MGI:6280027 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Slc25a48 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGACATGGCATGATAGGAGA and TTTGAAGGTGGCTTTGACAG, which resulted in a 1016 bp deletion beginning at Chromosome 13 position 56,450,617 bp and ending after 56,451,632 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000381058 (exon 4) and 757 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 54 and early truncation 4 amino acids later. |
