| Primary Identifier | MGI:6280645 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zfp423 |
| Inheritance Mode | Not Specified | Strain of Origin | Not Specified |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTGCATGTGTGCTTCCTAG and GCAGCTGGCCAACTGCTGCA, which resulted in a 3279 bp deletion beginning at Chromosome 8 position 87,780,106 bp and ending after 87,783,384 bp (GRCm38/mm10). This mutation deletes all but the first 29 bp of ENSMUSE00001238707 (exon 4) and 93 bp of flanking intronic sequence including the splice donor and is predicted to cause a change of amino acid sequence after residue 111 and early truncation 14 amino acids later. |
