|  Help  |  About  |  Contact Us

Allele : Zfp507<em1(IMPC)J> zinc finger protein 507; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6275176 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zfp507
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATGAAAGCAACAGGCGCTG and TTAGTTCTAGAATCTCAAGG, which resulted in a 2580 bp deletion beginning at Chromosome 7 position 35,793,294 bp and ending after 35,795,873 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000394835 (exon 3) and 484 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to remove the first 698 amino acids but retain the last 248 before the stop. In addition, there is a 2 bp insertion (GA) 14 bp before the deletion.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories