| Primary Identifier | MGI:6275176 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zfp507 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATGAAAGCAACAGGCGCTG and TTAGTTCTAGAATCTCAAGG, which resulted in a 2580 bp deletion beginning at Chromosome 7 position 35,793,294 bp and ending after 35,795,873 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000394835 (exon 3) and 484 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to remove the first 698 amino acids but retain the last 248 before the stop. In addition, there is a 2 bp insertion (GA) 14 bp before the deletion. |
