| Primary Identifier | MGI:6293902 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Spatc1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCAACCCCACACCAGAAGAG and CTACCCCTTTGCTAAGAACA, which resulted in a 9510 bp deletion beginning at Chromosome 15 position 76,283,317 bp and ending after 76,292,826 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000498536-ENSMUSE00000479099 (exons 2-5) and 8193 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 69 and early truncation 29 amino acids later. |
