|  Help  |  About  |  Contact Us

Allele : Syt8<em1(IMPC)J> synaptotagmin VIII; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6272647 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Syt8
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTACTACTGTAGCTTCCAA and CTAGGCCTTTCCCTGAAAAA, which resulted in a 1829 bp deletion beginning at Chromosome 7 position 142,438,739 bp and ending after 142,440,567 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001253691 through ENSMUSE00000668076 (exons 4-9) and 834 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 97 and early truncation 44 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories