| Primary Identifier | MGI:6281927 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rnase6 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project TCPR1241 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes and single guide RNA(s) with spacer sequences of CCCACAGCTCAAGCAGCAAT, TGACAGGTTCTGCGCTCTCG, and AAGCTCCGTTTTGATAGCGT targeting exon ENSMUSE00000617045. This resulted in a 536-bp del Chr14: 51130186 to 51130721 (GRCm38). |
