|  Help  |  About  |  Contact Us

Allele : Rnase6<em1(IMPC)Tcp> ribonuclease, RNase A family, 6; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6281927 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Rnase6
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NCrl
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project TCPR1241 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes and single guide RNA(s) with spacer sequences of CCCACAGCTCAAGCAGCAAT, TGACAGGTTCTGCGCTCTCG, and AAGCTCCGTTTTGATAGCGT targeting exon ENSMUSE00000617045. This resulted in a 536-bp del Chr14: 51130186 to 51130721 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele