|  Help  |  About  |  Contact Us

Allele : Iqch<em1(IMPC)J> IQ motif containing H; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6272676 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Iqch
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAAACGCCGTTTCGAGCGA and GTAATTGATGAAGTGTTAGT, which resulted in a 1108 bp deletion beginning at Chromosome 9 position 63,524,247 bp and ending after 63,525,354 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000324999 (exon 10) and 456 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 288, remove 188 amino acids, and return into frame for the stop codon.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories