|  Help  |  About  |  Contact Us

Allele : Exoc3l4<em1(IMPC)J> exocyst complex component 3-like 4; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6294137 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Exoc3l4
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGAGTTGTTAGGACCCAGG and AAGAGTCTAGATCACTCCAC, which resulted in a 592 bp deletion beginning at Chromosome 12 position 111,425,123 bp and ending after 111,425,714 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000116352 and ENSMUSE00000116361 (exons 5 and 6) and 357 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 352 and early truncation 1 amino acid later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories