| Primary Identifier | MGI:6294149 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Spty2d1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTATTGTGATGTGTGAGAGG and GATCTCGGAGAGCAGTGTAA, which resulted in a 2893 bp deletion beginning at Chromosome 7 position 46,997,270 bp and ending after 47,000,162 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000382653 and ENSMUSE00000339408 (exons 2 and 3) and 1245 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 20 and early truncation 83 amino acids later. |
