| Primary Identifier | MGI:6294082 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Slc17a2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAGGGTTCTTAGTTAGTAG and CCTACATCAGTCAAAGGCTG, which resulted in a 640 bp deletion beginning at Chromosome 13 position 23,814,821 bp and ending after 23,815,460 bp (GRCm38/mm10). This mutation deletes ENSMUSE0000124538 and ENSMUSE00001248222 (exons 4 and 5) and 318 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 80 and early truncation 14 amino acids later. |