| Primary Identifier | MGI:6281355 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Lurap1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTCATTATTTGTCTCCCAA and ACCTCGCTCCCCCAACTGCG, which resulted in a 566 bp deletion beginning at Chromosome 4 position 116,144,128 bp and ending after 116,144,693 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000337750 (exon 1) and 253 bp of flanking intronic sequence including the translation start and is predicted to result in a null allele. |
