|  Help  |  About  |  Contact Us

Allele : Ltv1<em1(IMPC)J> LTV1 ribosome biogenesis factor; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6294725 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ltv1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGGGTAACCATGTTCTAGT and TATAGCAGTGGAGCCCAGGC, which resulted in a 314 bp deletion beginning at Chromosome 10 position 13,182,791 bp and ending after 13,183,104 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000098234 (exon 5) and 178 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 132 and early truncation 43 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Ltv1<->,
  • Ltv1<->
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele