| Primary Identifier | MGI:6286371 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Calu |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project TCPR1263 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ATGCTTGGTTTAACTTCACC targeting the 5' side and CAGAGTAAGCGCATGGGCAC targeting the 3' side of a critical exon(s). This resulted in a 344-bp deletion of Chr6 from 29365924 to 29366267 (GRCm38). |
