| Primary Identifier | MGI:6273283 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Phf20l1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project TCPR1219 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ACGTGGCTGACTATCATCAT targeting the 5' side and AGTCAGTCACCTATTGTGCT targeting the 3' side of a critical exon. This resulted in a 476-bp del Chr15:66603886 to 66604361_insATAGTC resulting in a frameshift mutation in all annotated full length protein-coding transcripts.(GRCm38). |
