|  Help  |  About  |  Contact Us

Allele : Ttbk2<em1(IMPC)J> tau tubulin kinase 2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6314594 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ttbk2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGAGGGAAAGAGTAAATCAA and GACGGTTCCTTCAGAATCCA, which resulted in a 364 bp deletion beginning at Chromosome 2 position 120,760,099 bp and ending after 120,760,462 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001306611 (exon 11) and 206 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 343 and early truncation 17 amino acids later.
  • mutations:
  • Intragenic deletion,
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele