|  Help  |  About  |  Contact Us

Allele : Fancm<em1Jcs> Fanconi anemia, complementation group M; endonuclease-mediated mutation 1, John C Schimenti

Primary Identifier  MGI:6306300 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Fancm
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  A 7 bp deletion (CCCGTGC) was created in the coding region of exon 1 using an sgRNA (targeting CCAGCTGGTAGTCGCGCACGG) with CRISPR/Cas9 technology. This creates a frameshift and premature stop codon (p.P78Afs*56).
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Fancm<->,
  • Fancm<em1/Jcs>,
  • Fancm<em1/Jcs>,
  • Fancm<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories