| Primary Identifier | MGI:6306300 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fancm |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | A 7 bp deletion (CCCGTGC) was created in the coding region of exon 1 using an sgRNA (targeting CCAGCTGGTAGTCGCGCACGG) with CRISPR/Cas9 technology. This creates a frameshift and premature stop codon (p.P78Afs*56). |
