| Primary Identifier | MGI:6306477 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rr70 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR-targeting, using sgRNAS targeting TGGCAGGATTAGCAGTTCAG and GGACTAGAGACTCTTCCACT, inserted a floxed rabbit beta-globin transcriptional terminator sequence 28.6 kb downstream of upstream exon U1 and 14.3 kb upstream of the Snrpn promoter at the Angelman syndrome imprinting center (AS-IC). Three founders were used interchangeably. |