|  Help  |  About  |  Contact Us

Allele : Rr70<em1Rsnk> regulatory region 70; endonuclease-mediated mutation 1, James Resnick

Primary Identifier  MGI:6306477 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Rr70
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR-targeting, using sgRNAS targeting TGGCAGGATTAGCAGTTCAG and GGACTAGAGACTCTTCCACT, inserted a floxed rabbit beta-globin transcriptional terminator sequence 28.6 kb downstream of upstream exon U1 and 14.3 kb upstream of the Snrpn promoter at the Angelman syndrome imprinting center (AS-IC). Three founders were used interchangeably.
  • mutations:
  • Insertion,
  • Intragenic deletion
  • synonyms:
  • AS<Term>,
  • AS<Term>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele