| Primary Identifier | MGI:6273809 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Nphp3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGCCACCAAGTTTTCAGGG and CGAGCATCCATACAGCTCTG, which resulted in a 261 bp deletion beginning at Chromosome 9 position 104,005,379 bp and ending after 104,005,639 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001248887 (exon 3) and 110 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 169 and early truncation 19 amino acids later. |
