| Primary Identifier | MGI:6295124 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Stmn3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATAGGAACCACATTCTTGAG and GAGCAGGTACCATGATCCTG, which resulted in a 718 bp deletion beginning at Chromosome 2 position 181,308,568 bp and ending after 181,309,285 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000661112 and ENSMUSE00000591048 (exons 2 and 3) and 446 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 6 and early truncation 14 amino acids later. |