| Primary Identifier | MGI:6283587 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Slc38a6 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATTTGACTTAAGTACAAGT and TTGACTCTCACACATCAGAG, which resulted in a 377 bp deletion beginning at Chromosome 12 position 73,291,923 bp and ending after 73,292,299 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000365160 (exon 3) and 303 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 80 and early truncation 39 amino acids later. |