| Primary Identifier | MGI:6294895 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Bcap29 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGAAAAGATCTTAGTGTAAG and ACCCTGTCAGGTACTAAAGA, which resulted in a 355 bp deletion beginning at Chromosome 12 position 31,626,659 bp and ending after 31,627,013 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000107429 (exon 4) and 204 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 64 and early truncation 2 amino acids later. There is a 3 bp insertion (CTG) at the deletion site. |
