| Primary Identifier | MGI:6283645 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | S100a16 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTCCAGGACAAAGATCACCA and GCTGCTTTGTGGTTTTATAT, which resulted in a 1406 bp deletion beginning at Chromosome 3 position 90,541,810 bp and ending after 90,543,215 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000637998 and ENSMUSE00000637995 (exons 2 and 3) and 440 bp of flanking intronic sequence including the splice acceptor translation start and is predicted to result in a null allele. |
