|  Help  |  About  |  Contact Us

Allele : Nsmce4a<em1(IMPC)J> NSE4 homolog A, SMC5-SMC6 complex component; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6307013 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Nsmce4a
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTGGTCTTAGAGTGTTCTA and TGAGCTCTAAGACTGGTGAG, which resulted in a 469 bp deletion beginning at Chromosome 7 position 130,542,540 bp and ending after 130,543,008 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001241414 (exon 3) and 338 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 120 and early truncation 16 amino acids later. There is an 8 bp insertion at the del site (AGCTAGAG).
  • mutations:
  • Intragenic deletion,
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories