| Primary Identifier | MGI:6307013 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Nsmce4a |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTGGTCTTAGAGTGTTCTA and TGAGCTCTAAGACTGGTGAG, which resulted in a 469 bp deletion beginning at Chromosome 7 position 130,542,540 bp and ending after 130,543,008 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001241414 (exon 3) and 338 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 120 and early truncation 16 amino acids later. There is an 8 bp insertion at the del site (AGCTAGAG). |
