| Primary Identifier | MGI:6307018 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Avl9 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAGACCCTTTAAATCAGCT and TCTGGGCAGGAGGGAGCCGA, which resulted in a 786 bp deletion beginning at Chromosome 6 position 56,723,008 bp and ending after 56,723,793 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001208835 (exon 2) and 665 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 30 and early truncation 31 amino acids later. There is a single bp (T) insertion at the deletion site. |