|  Help  |  About  |  Contact Us

Allele : Avl9<em1(IMPC)J> AVL9 cell migration associated; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6307018 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Avl9
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAGACCCTTTAAATCAGCT and TCTGGGCAGGAGGGAGCCGA, which resulted in a 786 bp deletion beginning at Chromosome 6 position 56,723,008 bp and ending after 56,723,793 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001208835 (exon 2) and 665 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 30 and early truncation 31 amino acids later. There is a single bp (T) insertion at the deletion site.
  • mutations:
  • Insertion,
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories