| Primary Identifier | MGI:6284517 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cep68 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGTCTGTAAATCAAAGCCC and GTTTTCTTCACAAGACTGGG, which resulted in a 2580 bp deletion beginning at Chromosome 11 position 20,238,200 bp and ending after 20,240,779 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000333483 and ENSMUSE00000370638 (exons 3 and 4) and 954 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 104, the loss of 542 amino acids but remains in frame for the final 87 amino acids. |
