|  Help  |  About  |  Contact Us

Allele : Cep68<em1(IMPC)J> centrosomal protein 68; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6284517 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cep68
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGTCTGTAAATCAAAGCCC and GTTTTCTTCACAAGACTGGG, which resulted in a 2580 bp deletion beginning at Chromosome 11 position 20,238,200 bp and ending after 20,240,779 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000333483 and ENSMUSE00000370638 (exons 3 and 4) and 954 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 104, the loss of 542 amino acids but remains in frame for the final 87 amino acids.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories