|  Help  |  About  |  Contact Us

Allele : Gbp7<em1(IMPC)J> guanylate binding protein 7; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6284359 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Gbp7
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATGAATCCTTACAATACAGG and CTTGCAAGCAGCACAGAAGT, which resulted in a 477 bp deletion beginning at Chromosome 3 position 142,536,240 bp where there is a 4 bp retention TGCA after 142,536,490 and then the deletion continues for 227 bp ending after 142,536,720 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001000161 (exon 3) and 349 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acid 64.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories