| Primary Identifier | MGI:6284359 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gbp7 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATGAATCCTTACAATACAGG and CTTGCAAGCAGCACAGAAGT, which resulted in a 477 bp deletion beginning at Chromosome 3 position 142,536,240 bp where there is a 4 bp retention TGCA after 142,536,490 and then the deletion continues for 227 bp ending after 142,536,720 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001000161 (exon 3) and 349 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acid 64. |