| Primary Identifier | MGI:6284361 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Slc6a16 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTGGCCAGTGACGGATGCG and CTAACATTAGAAAGCTCCAG, which resulted in a 1706 bp deletion beginning at Chromosome 7 position 45,259,727 bp and ending after 45,261,432 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001034222 and ENSMUSE00000967546 (exons 4 and 8) and 892 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acids 160. |
